F GCCACTGTACCCAGCCTAATCTTG br R CACATCTCTACCAGAGTTAATCAACTGATGC br BRAF br

F:5’-GCCACTGTACCCAGCCTAATCTTG-3’ 287
R:5’-CACATCTCTACCAGAGTTAATCAACTGATGC-3’
BRAF
F:5’-CCTAAACTCTTCATAATGCTTGCTC-3’ 211
R:5’-GTGGAAAAATAGCCTCAATTCTTACC-3’
Clinical Colorectal Cancer Month 2019 - 3
Detection of HER2 Status in mCRC by ctDNA
Table 2 Correlations Between Clinicopathologic Characteristics of Patients With Colorectal Cancer and HER2 Status
HER2 Amplification/ HER2-negative P Value
Characteristic All Patients Overexpression
Gender
Primary tumor
Differentiation
Liver metastases
Lung metastasis
RAS
BRAF
Abbreviation: HER2 ¼ human epidermal growth factor receptor 2.
Genomic DNA Extraction, Library Preparation, and Sequencing
Genomic DNA was extracted from tumor tissues using a QIAamp DNA Mini Kit (Qiagen, Hilden, Germany). Peripheral blood samples (10 mL) were collected in EDTA Vacutainer tubes (BD Diagnostics, Franklin Lakes, NJ), stored at room temperature, and processed within 2 hours. Plasma was separated by centrifu-gation at 1600 g for 10 minutes, transferred to microcentrifuge tubes, and centrifuged at 16,000 g for 10 minutes to remove remaining cell debris. A mean volume of 1.5 mL (range, 0.8-2 mL) CT99021 was obtained after 2 steps of centrifugation. Cell-free DNA (cfDNA) was extracted from tumor tissues using a QIAamp Circulating Nucleic Acid Kit (Qiagen). Peripheral blood lympho-cyte genomic DNA (gDNA) was extracted using the DNeasy Blood
& Tissue Kit (Qiagen) and sequenced as the matched normal control sample. DNA concentration was measured using a Qubit fluorometer (Invitrogen, Carlsbad, CA) and Bioanalyzer 2100 (Agilent Technologies). The mean concentration of cfDNA in plasma was 52.35 ng/mL.
Peripheral blood lymphocyte gDNA was sheared to 300-bp fragments with a Covaris S2 ultrasonicator, followed by Indexed Illumina NGS library preparation (Illumina, San Diego, CA). cfDNA libraries were prepared using the KAPA DNA Library 
Preparation Kit (KapaBiosystems, Wilmington, MA). Libraries were hybridized to custom-designed biotinylated oligonucleotide probes (Roche NimbleGen, Madison, WI) covering the genes and exons that are most frequently mutated in CRC tumors. DNA sequencing was performed using the HiSeq 3000 Sequencing System (Illumina).
Analysis of ctDNA Abundance and HER2 CNV of ctDNA
Quality control was performed by filtering out the adapter se-quences and low-quality reads from the raw data. BWA (version 0.7.12-r1039) was used to align the clean reads to the reference human genome (hg19). Picard (version 1.98) was used to mark PCR duplicates. Realignment and recalibration was performed using GATK (version 3.4-46-gbc02625). Single nucleotide vari-ants were called using MuTect (version 1.1.4) and NChot, soft-ware developed in-house to review hotspot variants. Small insertions and deletions were called by GATK. Based on detected single nucleotide variants and small insertions and deletions, PyClone was used to identify clonal mutation, with the highest predicted cancer cell fraction.18 The mean variable allele fre-quency of clonal mutations was used to indicate the abundance for a single ctDNA sample. Relative ctDNA abundance at the first therapy evaluation was computed by comparison with abundance
Qing Wei et al
Table 3 Clinicopathologic Characteristics of 30 Patients Who Underwent ctDNA Tests
Characteristic No. Patients (%)
Total
Gender
Primary tumor
Differentiation
Liver metastases
Lung metastasis
RAS
BRAF
Abbreviation: ctDNA ¼ circulating tumor DNA.
at pretreatment. Somatic copy number alterations were identified with CONTRA (v2.0.8). In the CONTRA algorithm, base-level log-ratios between the case (ctDNA) and control (gDNA) were taken into consideration to eliminate GC bias and an imbalanced